Skip to main content

Table 4 Oligonucleotides used to synthesis dsRNA

From: Functional genomics tool: Gene silencing in Ixodes scapularis eggs and nymphs by electroporated dsRNA

Target gene Forward primer (5'-3') Reverse primer (5'-3')
Na+-K+-ATPase Alpha subunit (DN968449) ACGAAACTGCCGAGAGCGACATTA ATCCTGAGACCTTTGTCCATGCCT
β-Actin (DN972266) AAACATCCGACATGTGTGACGACGA TGTGGTGCCAGATCTTCTCCATGT
PLA2 (EW812932) TTTCCATCGCCACCTGGTATGTCT ATATTGGCTGCCTGCGTAACGACGA
Calreticulin (DN970315) TCTTTGCAACGTGGTTTCCTGAGC TCAGCAGGTTCTTGCCCTTGTAGT
Cystatin-intracellular (DQ066227.1) TGTTTGCATCGCAGGTCCGT CACTGGAAGTGCACGATCTCATCT
Syntaxin-5 (DN96995) ACATTGAGAGCACGATTGTGGAGC TGCCCAGCATAAATACAGCCCAGA
Cyclophilin G (DN972149) AGGACCCAAAGTTACCGACAAGGT TCTCAACCTTGCGTACCACATCCA
Cyclophilin A (DQ066345) AATAGTGCTCCTCGGTGAAGCCAA TGCCGAAAGACTCCATCTGCTTGT