Table 1 Genomes used for tag generation and testing.
From: Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR
Organism | Group | tag | Lanes in Figure 2 |
|---|---|---|---|
Gallus gallus | Animals | CACTCACAAGCTCGACGTACAC | 1 and 8 |
Canis familiaris | Animals | CAGACAGCACTCGTTCGTACAC | 2 and 9 |
Arabidopsis thaliana | Plants | GACTGAACGTGCTCTGCTACTG | 3 and 10 |
Sulfolobus acidocaldarius str. DSM639 | Crenarchaeota | CAGTCACAGCACACGAGTACAC | 4 and 11 |
Bartonella henselae str. Houston-1 | Alphaproteobacteria | CAGACACGAGCAACGACTACAC | 5 and 12 |
Bartonella henselae str. UGA 8 | Alphaproteobacteria | CAGACACGAGCAACGACTACAC | 6 and 13 |
Anabaena PCC7120 | Cyanobacteria | CACTCTGTGCTCGTTGCTACAC | (Figure 3) |
Synechocystis PCC 6803 | Cyanobacteria | CAGACAGCAAGCAGCACTACAC | (Figure 3) |