Skip to main content

Table 1 Oligonucleotide sequences used in the gene expression analysis

From: Antibacterial effect of cerium oxide nanoparticle against Pseudomonas aeruginosa

Gene Oligonucleotide Sequence Tm (°C) GC (%)
shv Forward TTCTATCATGCCTACGCGGC 60. 32 55. 00
  Reverse ATCTCCCTGTTAGCCACCCT 59. 96 55. 00
imp Forward AAGAAGTTAACGGGTGGGGC 60. 25 55. 00
  Reverse CACGCTCCACAAACCAAGTG 59. 97 55. 00
kpc Forward TGTGTACGCGATGGATACCG 59. 97 55. 00
  Reverse TTTTGCCGTAACGGATGGGT 60. 25 50. 00
16S Forward CCACGCCACTGATCTTCCAT 60.11 55.00
  Reverse CTGGACCATGATCGAGAGCC 59.97 60.0