Table 1 Oligonucleotide sequences used in the gene expression analysis
From: Antibacterial effect of cerium oxide nanoparticle against Pseudomonas aeruginosa
Gene | Oligonucleotide | Sequence | Tm (°C) | GC (%) |
|---|---|---|---|---|
shv | Forward | TTCTATCATGCCTACGCGGC | 60. 32 | 55. 00 |
| Â | Reverse | ATCTCCCTGTTAGCCACCCT | 59. 96 | 55. 00 |
imp | Forward | AAGAAGTTAACGGGTGGGGC | 60. 25 | 55. 00 |
| Â | Reverse | CACGCTCCACAAACCAAGTG | 59. 97 | 55. 00 |
kpc | Forward | TGTGTACGCGATGGATACCG | 59. 97 | 55. 00 |
| Â | Reverse | TTTTGCCGTAACGGATGGGT | 60. 25 | 50. 00 |
16S | Forward | CCACGCCACTGATCTTCCAT | 60.11 | 55.00 |
| Â | Reverse | CTGGACCATGATCGAGAGCC | 59.97 | 60.0 |