Table 1 Primer sequence and parameters, the nucleotides of inner primers differ between Ye et al., [10] and manually modified are shown in bold, underlined, and italic letters
SNP | Primer | Primer Sequence | Intended Allele | Product size (bp) | Melting temperature (Tm) (°C) | Tm Difference (°C) | Designed |
|---|---|---|---|---|---|---|---|
rs438228855 (CVM) | OF | 5′ TGGAAATGGTTGCATTTTTACCTTAAG | Both allele | 389 | 54.7 | 0.5(OF/OR) | Ye et al., 2001 [10] |
OR | 5′ TTGCAACAACAAGCAGTTTTTATAAGG | 55.2 | |||||
IF | GGCTCACAATTTGTAGGTCTCATGGTAT | Mutant | 242 | 58.5 | 3.3(IF/OR) | ||
IR | ACTGGAAAAACATGCTGTGAGGAC | Wild | 199 | 57.7 | 3.0(OF/IR) | ||
IF | 5′ GCTCACAATTTGTAGGTCTCATGTCAT | Mutant | 242 | 57.2 | 2.0(IF/OR) | Manual modification | |
IR | 5′ ACTGGAAAAACATGCTGTGACAAC | Wild | 199 | 56.4 | 1.7(OF/IR) |