Skip to main content

Table 1 Primer sequence and parameters, the nucleotides of inner primers differ between Ye et al., [10] and manually modified are shown in bold, underlined, and italic letters

From: Designing, optimization, and validation of whole blood direct T-ARMS PCR for precise and rapid genotyping of complex vertebral malformation in cattle

SNP Primer Primer Sequence Intended Allele Product size (bp) Melting temperature (Tm) (°C) Tm Difference (°C) Designed
rs438228855
(CVM)
OF 5′ TGGAAATGGTTGCATTTTTACCTTAAG Both allele 389 54.7 0.5(OF/OR) Ye et al., 2001 [10]
OR 5′ TTGCAACAACAAGCAGTTTTTATAAGG 55.2
IF GGCTCACAATTTGTAGGTCTCATGGTAT Mutant 242 58.5 3.3(IF/OR)
IR ACTGGAAAAACATGCTGTGAGGAC Wild 199 57.7 3.0(OF/IR)
IF 5′ GCTCACAATTTGTAGGTCTCATGTCAT Mutant 242 57.2 2.0(IF/OR) Manual modification
IR 5′ ACTGGAAAAACATGCTGTGACAAC Wild 199 56.4 1.7(OF/IR)