Skip to main content

Table 1 Probes, primers, and target sequences used in CL and NCL probe-AuNP hybridization assay, RT-nested multiplexPCR, and real-time RT-PCR

From: Development and comparison of cross-linking and non-crosslinking probe-gold nanoparticle hybridization assays for direct detection of unamplified bovine viral diarrhea virus-RNA

Assay Name Sequence (5′ 3′) Reference
CL or NCL probe-AuNP hybridization assay Probe-A TTCAGCCATCCAACG A(10) SH This paper
Probe-B SHA(10) TACCCTGTACTCAGG This paper
Target CGTTGGATGGCTGAAGCCCTGAGTACAGGGTA This paper
Mismatch target CGATGGATCGCTGAAGCCCTGAGTACGGGCTA This paper
Deleted target CGTGATGGCTGAAGCCCTGAGTACGGTA This paper
RT-nested multiplexPCR ExF AAGATCCACCCTTATGA(A/G)GC [41]
ExR AAGAAGCCATCATC(A/C)CCACA [41]
InF BVDV-1 TGGAGATCTTTCACACAATAGC [41]
Inf BVDV-2 GGGAACCTAAGAACTAAATC [41]
InR GCTGTTTCACCCAGTT(A/G)TACAT [41]
Real-time RT-PCR Pesti-3F CCTGAGTACAGGRTAGTCGTCA [42]
Pesti-4R GGCCTCTGCAGCACCCTATCA [42]
TQ-Pesti-Probe FAM-TGCYAYGTGGACGAGGGCATGC-BHQ-1 [42]