Skip to main content

Table 1 Gene primers for Rattus norvegicus with accession number, amplicon size and standard deviation in different cell/tissue types

From: Optimizations for identifying reference genes in bone and cartilage bioengineering

  Gene Accession Number 5′ sequence 3′ sequence Amplicon length (bp) Precision (Std.Dev.)
Reference genes Tbp BC081939.1 TAACCCAGAAAGTCGAAGAC CCGTAAGGCATCATTGGA 185 0.02a/0.04b/0.13c
Gapdh BC083511.1 CATGGGTGTGAACCATGA TGTCATGGATGACCTTGG 104 0.04/0.19/0.17
Polr2e BC158787.1 GACCATCAAGGTGTACTGC CAGCTCCTGCTGTAGAAAC 151 0.08/0.16/0.13
Rplp0 BC001834.2 CAACCCAGCTCTGGAGA CAGCTGGCACCTTATTGG 116 0.10/0.05/0.36
Sdha NM_130428.1 GCGGTATGACACCAGTTATT CCTGGCAAGGTAAACCAG 239 0.09/0.07/0.08
Rpl13α NM_173340.2 TTTCTCCGAAAGCGGATG AGGGATCCCATCCAACA 159 0.16/0.03/0.11
Actb NM_031144.3 AGCTATGAGCTGCCTGA GGCAGTAATCTCCTTCTGC 243 0.16/0.33/0.08
Rna28s4 NR_145822.1 GCGGCCAAGCGTTCATA CCTGTCTCACGACGGTCTAA 143 0.10/0.07/0.16
Genes of interest Tgf-β1 NM_021578.2 TTTAGGAAGGACCTGGGTT ACCCACGTAGTAGACGATG 210 0.04/0.11/0.11
Tgf-β3 NM_013174.2 AACCTAAGGGTTACTATGCC ACCACCATGTTGGACAG 214 0.06/0.06/0.08
Sox9 NM_080403.1 CCAGAGAACGCACATCAAG GGTGGTCGGTGTAGTCATA 161 0.07/0.12/0.08
Runx2 NM_001278484.2 CCCAAGTGGCCACTTAC CTGAGGCGGTCAGAGA 118 0.18/0.10/0.32
Acan NM_022190.1 CAAGTGGAGCCGTGTTT GAGCGAAGGTTCTGGATTT 156 0.01/0.13/0.04
Bmp-6 NM_013107.1 GGACATGGTCATGAGCTTTG GTCAGAGTCTCTGTGCTGAT 232 0.43/0.08/0.22
Bmp-2 NM_017178.1 GGAAGTGGCCCACTTAGA TCACTAGCAGTGGTCTTACC 113 0.08/0.09/0.01
Ocn NM_013414.1 ACCTGGCAGGTGCAAA CTCACACACCTCCCTGTG 237 0.03/0.08/0.11
  1. aBMSCs, bmuscle tissue, cadipose tissue. Tbp TATA-binding protein, Gapdh Glyceraldehyde 3-phosphate dehydrogenase, Polr2e RNA polymerase II subunit e, Rplp0 Ribosomal protein lateral stalk subunit P0, Sdha Succinate dehydrogenase complex flavoprotein sub-unit A, Rpl13α Ribosomal protein L13α, Actb Actin beta, Rna28s4 RNA 28S ribosomal 4, Tgf-β1 transforming growth factor, beta 1, Tgf-ß3 transforming growth factor, beta 3, Sox9 SRY (Sex Determining Region Y)-Box 9, Runx2 Runt-related transcription factor 2, Acan Aggrecan, Bmp-6 Bone morphogenetic protein 6, Bmp-2 Bone morphogenetic protein 2, Ocn Osteocalcin