Table 2 Protospacer sequences selected for the gene editing of A. aculeatus TBRC 277
From: Development of a CRISPR/Cpf1 system for targeted gene disruption in Aspergillus aculeatus TBRC 277
Spacer ID | Gene target | Genomic target sequence (5′> 3′) | PAM | Promoter | Location (ATG Start) |
|---|---|---|---|---|---|
pyrG-1 | pyrG | GCCAGCGGGTTGGTGTGCTT | TTTN | U3-AF | 43–62 |
pyrG-2 | pyrG | GGCGGGGCCCTACGGTCAGC | TTTN | U3-AF | 151–170 |
pyrG-3 | pyrG | TCATGGGGTTCGTGTCGACG | TTTN | U3-AF | 632–650 |