Skip to main content

Table 1 Gene primer sequences for test and reference genes

From: Trauma induced tissue survival in vitro with a muscle-biomaterial based osteogenic organoid system: a proof of concept study

GeneForward Primer (5′-3′)Reverse Primer (5′-3′)
VEGF-ACTACCAGCGCAGCTATTGGATCCGCATGATCTGCATAG
COL4A1CTGGGAATCCCGGACTTGGGATCTCCCTTCATTCCT
TGF-β1TTTAGGAAGGACCTGGGTTACCCACGTAGTAGACGATG
BMP-2GGAAGTGGCCCACTTAGATCACTAGCAGTGGTCTTACC
RUNX-2CCCAAGTGGCCACTTACCTGAGGCGGTCAGAGA
RPLP0 (reference)CAACCCAGCTCTGGAGACAGCTGGCACCTTATTGG
SDHA (reference)GCGGTATGACACCAGTTATTCCTGGCAAGGTAAACCAG
POLR2E (reference)GACCATCAAGGTGTACTGCCAGCTCCTGCTGTAGAAAC
TBP (reference)TAACCCAGAAAGTCGAAGACCCGTAAGGCATCATTGGA