Skip to main content

Table 1 Sequences, melting temperature, and amplicon size of primers used for RT-PCR

From: The osteogenic differentiation of human dental pulp stem cells in alginate-gelatin/Nano-hydroxyapatite microcapsules

Target Sense and antisense sequences
5′ to 3’
tA (°C) bp
BMP-2 F: GAGAAGGAGAGGCAAAGAAAG 61/59 183
R:GAAGCAGCAACGCTAGAGAC
Osteocalcin F: ATTGTGGCTCACCCTCCATCA 60 119
R: AGGGCTATTTGGGCGTCATC
Osteonectin F:GCAGAGGAAACCCAAGAGGAG 60 208
R: TGGCAAAGAAGTGGCAGCAG
RUNX-2 F:ACCTTGACCATAACCGTCTTC 67/57 145
R: GGCGGTCAGAGAACAAACTA
DSPP F:CTGGTGCATGAAGGTCATAGAG 57 90
R: CAATTTGCGGATCTCAGAGG
GAPDH F: GAAGGTGAAGGTCGGAGTC 65 100
R: GAAGATGGTGATGGGATTTC