Skip to main content

Table 3 Forward and reverse primers used to amplify specific kinase genes. Note also preferred vector for each construct

From: Novel kinase platform for the validation of the anti-tubercular activities of Pelargonium sidoides (Geraniaceae)

Kinase Gene and Rv identifier Forward and Reverse primers (5′ → 3′) Restri-ction Enzyme Recogni-tion site (underli-ned) Selected pET vector
NDK ndkA Rv2445c ndkA-Fwd   pET-16b
GGCATATGACCGAACGGACTCTGGTACTG NdeI  
ndkA-Rev
GTGGATCCTTAGGCGCCGGGAAACCAG BamHI  
HSK thrB Rv1296 thrB-Fwd   pET-20a
GGCATATGGTGACTCAAGCATTG NdeI  
thrB-Rev
GTCTCGAGACCGGGAACTCTTACTG XhoI  
AK ackA
Rv0409
ackA-Fwd   pET-16b
GGCATATGGAGTAGCACCGTGCTGGTGATCAA NdeI  
ackA-Rev
GTGGATCCTTACGCTCGGCGTCCGCCCAG BamHI  
GK glpK
Rv3696c
glpK-Fwd   pET-16b
(GGCATATGTCCGACGCCATCCTAG NdeI  
glpK-Rev
CATGTCGACTTAGGACACGTCAACCCAATCC SalI  
ThiL thil
Rv2977c
thil-Fwd   pET-28a
GGTACATATGACCACTAAAGATCACTC NdeI  
thil-Rev
GATCTCGAGTTACCCTAGCGAACCTTG XhoI  
RBKS rbks
Rv2436
rbks-Fwd   pET-28a
GTACATATGGCAAACGCCAGTGAG NdeI  
rbks-Rev
GATCTCGAGTTATGAACCGTTGTG XhoI  
AsKa ask
Rv3709c
ask alpha-Fwd   pCDF-
GATTACATATGGCGCTCGTCGTGCAG NdeI Duet-1
ask alpha-Rev   (alpha)
GATGTCGACTTACCGTCCCGTCCCCG-3’ SalI  
ask beta-Fwd   pET-26a
GATCATATGGAAGACCCCATCCTGACCG NdeI (beta)
ask beta-Rev   
GCCCCTGCCCTGCCCAGCTGTATG SalI  
SK aroK
Rv2539c
Primers were not designed as the aroK plasmid was received from the laboratory of Chris Abell, University of Cambridge   pET-15b
  1. a AsK consists of 2 hetero-monomers (alpha and beta), to be co-expressed