Skip to main content

Table 6 The primers and probe sequences for the virulence factors

From: An improved quantitative real-time polymerase chain reaction technology for Helicobacter pylori detection in stomach tissue and its application value in clinical precision testing

Virulence FactorCategorySequence (5′ → 3′)a
vacA s1Forward primer (F)ACACCGCAAAATCAATCGCC
Reverse primer (R)CCCCAACAATGGCTGGAATG
Probe 1 (P1)HEX-GCATCACACCGCAACAAAGT-BHQ2
Probe 2 (P2)HEX-GCGCCATACCGCAAGAGAGT-BHQ2
vacA m1Forward primer 1 (F1)ATCAATTATTTGGTCCGAGGC
Forward primer 2 (F2)ATCAACTATCTGGTCCGAGGC
Reverse primer (R)GCTGTTAATCTTCATGAGCGGT
Probe 1 (P1)FAM-GATAGCGCGACTGGGTTTTA-BHQ1
Probe 2 (P2)FAM-GACAGCGCGACCGGATTTTA-BHQ1
cagAForward primer (F)GTGCCTGCTAGTTTGTCAGC
Reverse primer (R)ACGAGCTTAAGCCACTCAGG
Probe 1 (P)Texas Red-GCTATTAACAGCCACACACGC-Dabcyl
babA2Forward primer (F)GAAATCCCTAATACTAAATCC
Reverse primer (R)GTAAAAGCCGTCGTCTTCAGC
Probe 1 (P1)CY5-GGAGAAAAAACATGAAAAAACA-BHQ3
Probe 2 (P2)CY5-GGGGAGAAAACATGAAAAAACA-BHQ3
  1. aNote: HEX, FAM, Texas Red and CY5 are the fluorescence reporters. BHQ1, BHQ2, BHQ3 and Dabcyl are the fluorescence quenchers