Skip to main content

Table 5 glmM primers and probes sequences

From: An improved quantitative real-time polymerase chain reaction technology for Helicobacter pylori detection in stomach tissue and its application value in clinical precision testing

CategorySequence (5′ → 3′)
Forward primer 1(F1)GCTCTCACTTCCATAGGCTATAATG
Forward primer 2(F2)GCTTTAACTTCCATAGGCTATAATGT
Reverse primer(R)GCGCATGTCTTCGGTTAAAA
Probe 1(P1)FAM-TAGGGCCTATGCCTACCCCTGCGA-HBQ1a
Probe 2 (P2)FAM-TAGGGCCTATGCCCACCCCTGC-HBQ1
  1. aFAM is the fluorescence reporter, and HBQ1 is the fluorescence quencher