Skip to main content

Table 2 Primer sequences used in direct PCRs and stuntmer PCRs

From: A new primer construction technique that effectively increases amplification of rare mutant templates in samples

GenePrimer nameSequence (5′➔ 3′)Amplicon size
Traditional PCR
 EGFR exon 19Exon 19_ForwardGCAATATCAGCCTTAGGTGCG323 bps
Exon 19_ReverseAGCAGCTGCCAGACATGAGA
 EGFR exon 20Exon 20_ForwardGAAACTCAAGATCGCATTCATG365 bps
Exon 20_ReverseCAAACTCTTGCTATCCCAGGAG
 EGFR exon 21Exon 21_ForwardCAGCCATAAGTCCTCGACGTG399 bps
Exon 21_ReverseGAGCTCACCCAGAATGTCTGG
Stuntmer PCR (see NOTE)
 EGFR exon 19 deletion
  ForwardCCCGTCGCTATCAAGGAATTAAGAGAAGCAAC-C3-TAAAATTCCCGTCGCT148 bps
  ReverseAGCAGCTGCCAGACATGAGA
 EGFR S768
  ForwardTACGTGATGGCCAGCGTGGACAACC-C3-CCAGGAAGCCTACGTGAT277 bps
  ReverseCAAACTCTTGCTATCCCAGGAG 
 EGFR T790
  ForwardACCGTGCAGCTCATCACGCAG-C3-CTCACCTCCACCGTGCA213 bps
  ReverseCAAACTCTTGCTATCCCAGGAG 
 EGFR L858
  ForwardGATTTTGGGCTGGCCAAACTGCTGG-C3-AGCATGTCAAGATCACAGATTTT203 bps
  ReverseGAGCTCACCCAGAATGTCTGG 
  1. The R region: red; E region: blue; linker (C3):grey; overlapping area: highlighted in yellow