Skip to main content

Table 4 PCR primers for 35S promoter amplification. The M35F primer is derived from Wu et al. 2014 [20] and the M3R is from Fernandez et al. 2005 [21]. Both primers were synthesised by Sigma with HPLC purification

From: Lack of specificity associated with using molecular beacons in loop mediated amplification assays

Target, Type, Notation

Primer Sequence (5’ to 3’)

35Sp, Forward, M25F

CATCATTGCGATAAAGGAAAGGC

35Sp, Reverse, M3R

TCTTGCGAAGGATAGTGGGATT