Skip to main content

Table 3 LAMP molecular beacons designed for 35S promoter and NOS terminator sequences

From: Lack of specificity associated with using molecular beacons in loop mediated amplification assays

Target, Type, Vers., Tm, GC, length Primer Sequence (5’ to 3’)
ompW, LBP, WL, 69.8, 69.2, 25 [6FAM]AGCGGCTGCAGCCCTACTAGCCGCT[Dabcyl]
35Sp LoopF, 5nt FAM, 76.8, 66.6, 24 [6FAM]CCGAGCCACTGACGTAAGGCTCGG[OQA]
35Sp stem, 4nt FAM, 63.1, 61.1, 18 [6FAM]CCACTGGAACGTCTGTGG[BHQ1]
35Sp stem, 5nt FAM, 72.7, 65.0, 20 [6FAM]CGCACTGGAACGTCTGTGCG[BHQ1]
35Sp stem, 5nt JOE, 72.7, 65.0, 20 [JOE]CGCACTGGAACGTCTGTGCG[BHQ1]
35Sp stem, 6nt FAM, 77.9, 68.1, 22 [6FAM]CGGCACTGGAACGTCTGTGCCG[BHQ1]
35Sp stem, 7nt FAM, 82.0, 70.8, 24 [6FAM]CCGGCACTGGAACGTCTGTGCCGG[BHQ1]
NOSt stem, 5nt FAM, 66.0, 43.4, 23 [6FAM]CGCACTTACATGTTAATTGTGCG[BHQ1]
NOSt stem, 5nt FAM, 66.0, 43.4, 23 [JOE]CGCACTTACATGTTAATTGTGCG[BHQ1]
  1. The fluorophores used were 6-carboxyfluoroscein (6FAM) and 4’, 5’-dichloro-2’, 7’-dimethoxy-5(6)-carboxyfluorescein (JOE). The quenchers used were 4-(dimethylaminoazo)benzene-4-carboxylic acid (Dabcyl), Onyx Quencher A (OQA) and Black Hole Quencher 1 (BHQ1). Molecular beacon version WL was designed by Liu et al. 2017 [10] to detect part of the ompW gene from Vibrio cholerae
\