Skip to main content

Table 2 LAMP primers for 35S promoter, NOS terminator and LTR sequences

From: Lack of specificity associated with using molecular beacons in loop mediated amplification assays

Target, Type, Notation, Version Primer Sequence (5’ to 3’)
35Sp, Displacement, F3, GK CTTATATAAGAGGAAGGGTCT
35Sp, Displacement, B3, GK GATAAAGGAAAGGCTATCATT
35Sp, LAMP, FIP, GK CCACGTCGGCAAAGCAAGTGG-TTTT-
  GGATAGTGGGATTGTGCGTC
35Sp, LAMP, BIP, DL TTCCACGATGCTCCTCG-TTTT-CCTCTGCCGACAGTGG
35Sp, Loop, LoopF, DL TCCACTGACGTAAGGG
35Sp, Loop, LoopB, DL GGGGTCCATCTTTGGG
NOSt, Displacement, F3, DL CGCGATAATTTATCCTAGTTTG
NOSt, Displacement, B3, DL CGTTCAAACATTTGGCAAT
NOSt, LAMP, FIP, PH GCATGACGTTATTTATGAGA-TTTT-
  TCGCGCTATATTTTGTTTTCTA
NOSt, LAMP, BIP, PH CATGCTTAACGTAATTCAACA-TTTT-
  TGAATCCTGTTGCCGGTC
NOSt, Loop, LoopF, DL GATTAGAGTCCCGCAATTATAC
NOSt, Loop, LoopB, DL AAATTATATGATAATCATCGCAA
LTR, Displacement, F3, PH ACAGATGGTCCCCAGATGC
LTR, Displacement, B3, PH TCAATCGGAGGACTGGCG
LTR, LAMP, FIP, PH ATTTCAGGTCCTTGGGGCACCCCAGCCCTCAG
  CAGTTTC
LTR, LAMP, BIP, PH ACCAATCAGTTCGCTTCTCGCTGAGGGGTTGT
  GGGCTCTT
LTC, Loop, LoopF, PH CTGATGGTTCTCTAGA
LTC, Loop, LoopB, PH TTCGCGCGCTTCTGCT
  1. Primers targeting the 35S promoter and NOS terminator have been previously described and are attributable to David Lee (DL) [16] and Guy Kiddle (GK) [17]. The Moloney Murine Leukaemia Virus LTR LAMP primers are described for the first time
\