Skip to main content

Table 4 Single-target M13 LASSO probe design

From: Quantitative assessment of LASSO probe assembly and long-read multiplexed cloning

Sequence Name Sequence (5′-3′)
M13_137 GCAATCCGCTTTGCTTCTGACTATAATAGTCAGGGTAAAGACCTAGAGAAGTCCTAGCACGGTAACCTCCGAGGATGTCATCAAAGAGTTTAAAGAGTTTATGAGATTTAAGGTCAAGATGGAGGGAAGCGTCAACGGACACGAGTTCGAGATTGAGGGAGAAGGAGAAGGCCGGCCTTACGAGGGCACACAAACCGCTAAGCTCAAGGTCACAAAAGGAGGACTAACTATAACGGTCCTAAGGTAGCGAACCCTCCCCTTCTCCTGGGATATTCTGAGCCCTCAGTTCCAGTACGGAAGCAAAGCCTATGTTAAACACCCTGCCGACATCCCTGACTATCTGAAGCTCTCCTTCCCTGAAGGCTTCAAGTGGGAGAGATTCATGAACTTCGAGGACGGAGGCGTGGTGACAGTCACACAAGATAGCACCCTCCAGGACGGAGAGTTTATTTATAAGGTGAAACTCAGAGGAACCAACTTCCCCTCCGATGGCCCTGTCATGAATTCTTGGAGTTTGCTTCCGGTCTGGTTCGCTTTGAA