Skip to main content

Table 3 Primer sequences for LASSO assembly and capture

From: Quantitative assessment of LASSO probe assembly and long-read multiplexed cloning

Primer Sequence (5′-3′)
BlaF GAGTATTACCGCGGCGAATTC
RFPR200EcoRI AAGCTGGAATTCGCTTCCGTACTGGAACTGAGGGC
SapINew GGTTCCTGGCTCTTCGATC
TiolNew A*T*C*GCCGCAAGAAGTGTU
PCR1kbCaptF400 GTGAAACTCAGAGGAACCAACTTCC
ICeul200CaptF CTCCCCTTCTCCTGGGATATTCTG
M13_137_R(Tiol) TTCAAAGCGAACCAGACCGG
M13_137_F(SapINew) /5Phos/GCAATCCGCTTTGCTTCTGAC
  1. “*” symbol denotes phosphorothioate bonds while /5Phos/ indicates a phosphorylated 5′ end