Skip to main content

Table 3 PCR primers used in the present study

From: Improved the expression level of active transglutaminase by directional increasing copy of mtg gene in Pichia pastoris

Primer name Primer sequence (5′ → 3′)
P1 ACACTCGAGaaaagaGACTCCGACGACAGGGTCAC
P2 TATGCGGCCGCTCAATGGTGATGGTGATGATGCGGCCAGCCCTGC
P3 ACACTCGAGaaaagaGACAAT GGC GCG GGG GAAG
P4 TATGCGGCCGCTCAATGGTGATGGTGATGATGGGGAGCCCGGAACG
P5 TATGCGGCCGCCAGCTTTCTAGAACAAAAACTCATCTC
P6 CTTAAATATTAGGAAAAACGGTAACCTTATCTCACTTAATCTTCTGTACTCTG
P7 CAGAGTACAGAAGATTAAGAGAGATAGTTAGGTTACCGTTTTTCCTAATATTTAAG
P8 CGCGGATCCCTTCCACCAACAGTCAACCACCAGTC
P9 GGTATTAACGGTTTCGGACGTATTG
P10 GATGTTGACAGGGTCTCTCTCTTGG
P11 TGAAGAAAGAATTGGCTAACGG
P12 AGCTGGTCTGAAAGCATCTGG
  1. Remarks: The underlined sites are those for the digestion of restriction enzymes XhoI. The wavy line sites are those for the digestion of restriction enzymes NotI. The double corrugated underlined sites are the ones for the digestion of restriction enzymes BamHI. 6xHis-tag label sequence is indicated by the dotted line. The Kex2-endopeptidase recognition site is marked with lowercase letters. The bold underlining represents the sequence of overlapping segments of the AOX1 terminator-rDNA fusion gene