Skip to main content

Table 3 Primers used in this study

From: Recovery of recombinant Mycobacterium tuberculosis antigens fused with cell wall-anchoring motif (LysM) from inclusion bodies using non-denaturing reagent (N-laurylsarcosine)

Fragment Primer sequence (5′ to 3′)a Expected product size (base pair)
ARL Forward GGATCCGAATTCGCTGACCAGCGAGCTGCCGC 1244
Reverse GCGGCCGCTTATTTTATTCGTAGATACTGAC  
lysM Forward CTGCAGCCATGGCGGCTGGAAGACGAGATGAAA 608
Reverse GCGGCCGCTTATTTTATTCGTAGATACTGAC  
AR Forward GGATCCGAATTCGCTGACCAGCGAGCTGCCGC 613
Reverse GCGGCCGCTGGCTTCCCTTCCGAAACCGC  
Reverse CTGCAGGCTGGCTTCCCTTCCGAAACCGC  
pRSF:Duet-1 Forward GGATCTCGACGCTCTCCCT 200
Reverse TTGTACACGGCCGCATAATC  
  1. aRestriction enzyme (RE) sites are shown as bold and underlined is either BamHI (GGATCC), PstI (CTGCAG) or NotI (GCGGCCGC)