Skip to main content

Table 1 Oligonucleotides used in this study

From: Integrating vectors for genetic studies in the rare Actinomycete Amycolatopsis marina

Oligonucleotide Sequence (5′-3′)
pHG1A-for CGAACGCATCGATTAATTAAGGAGGATCGTATGACGACCGTTCCCG
pHG1A-rev CGTGGTGGGCGCTAGCCTCCTCTAGTCATCCGTCG
pHG1-for ACTAGAGGAGGCTAGCTTCAATGGAGGAGATGATCGAGG
pHG1-rev GCAGGTCGACTCTAGATCTCGCTACGCCGCTACG
pHG4-for CGAACGCATCGATTAATTAAGCGGCCGCCATATGGAATTCGGTACCGCATGCAGATCTAGGAACTTCGAAGTTCCCGC
pHG4-rev TGATTACGCCAAGCTTTCGACTCTAGAGTAAGCGTCACGG
pJH1R4-for CTAGCGATTGCCATGACGTCGGAGCTGCTTACCAATGTC
pJH1R4-rev AAGAGGCCCGCACCGATTCCAAGAGGCCGGCAACTAC
TG1-attB-Am-for TCGATCTCCAGTGCGGGCAAGACGTTCAACTGCACCGGCTGGAAGATCGGGACCACCGGACGAACGCA
TG1-attB-Sa-for TCGATCAGCTCCGCGGGCAAGACCTTCTCCTTCACGGGGTGGAAGGTCGGCGGTGGAGCTCGGAGA
R4-attB-Am-for GGTTGCCCATCACCATGCCGAAGCAGTGATAGAAGGGAACCGGGATGCAGGTGAGAAGGTGCTCGTGT
R4-attB-Sp-for AGTTGCCCATGACCATGCCGAAGCAGTGGTAGAAGGGCACCGGCAGACACGGTGAGAAGGTGCTCGTGT
attB-rev CTGCATCTCAACGCCTTCCGG
TG1-attP-for AACCTTCACGCTCATGCC
TG1-attP-rev GTCGAGATTCTCCGTCTCCTG
R4-attP-for GATCGGTCTTGCCTTGCTC
R4-attP-rev ACCCGCAGAGTGTACCCA
TG1-attL-Am-for ACAACCCCACCGGCACCGTCTTCA
TG1-attL-Am-rev AGTATAGGAACTTCGAAGCAGCTC
R4-attL-Am-for CGGCCGGTGATGTTGACGT
R4-attL-Am-rev TCGGCCGTCACGATGGTCA
  1. The attB sequences are shown underlined