Skip to main content

Advertisement

Table 1 Primers used to amplify genes

From: Mutagenesis of FAD2 genes in peanut with CRISPR/Cas9 based gene editing

Primer name Forward sequence (5′-3′) Reverse sequence (5′-3′)
FAD2 GAGGGCGTGTCACTAAGATTG GGCCATCCTAGTGTGAGTGT
ahFAD2A GATTACTGATTATTGACTT CCAACCCAAACCTTTCAGAG
ahFAD2B CAGAACCATTAGCTTTG CTCTGACTATGCATCAG
BAR GCACCATCGTCAACCACTAC GAAGTCCAGCTGCCAGAAAC
Cas9 GATCGCAAAGTCTGAGCAGG GATGAATCAGTGTGGCGTCC