Skip to main content

Table 2 List of the primers used to create the plasmid and strains and primers used for RT-PCR analysis

From: Characterizing active transportation mechanisms for free fatty acids and antibiotics in Synechocystis sp. PCC 6803

  Sequence (5′-3) Reference
Primer Name
 A 3Z slr 2131 end F GAG AGA GCT CGA CCC CGT TGT GTT AA this research
 A 3Z slr 2131 center R GAT TTA TTT TCT TGG ATC CCA TTA CGG CCG ACA TTG TTA CAT ATC T this research
 A 3Z sll 0180 end F CCT GGA GCT CTT GAC AAT GAC GAC AAT C this research
 A 3Z sll 0180 center R TTT TTA GTT CTG GAT CCC ATT ACG GCC GTA GTT AAT TGA CTC A this research
 B 3Z slr 2131 center F TGT AAC AAT GTC GGC CGT AAT AGG ATC CAA GAA AAT AAA TCT GGT CTT ATT this research
 B 3Z slr 2131 end R GCG CGT CTA GAT ATC CCA GTT CCA TTC TTT G this research
 B 3Z sll 0180 center F TGA GTC AAT TAA CTA CGG CCG TTG GAT CCA GAG AAC TAA AAA GTC TA this research
 B 3Z sll 0180 end R CGG GTC TAG ACT GCT GGG CAT TAT C this research
 Kan BamHI CAT TAC ACC AAG GAA TTA GGA TCC GTC GAC C this research
 EagI SacB ATA TCG GCC GGA ACA TCG ACA AAT ACA TAA GGA AT this research
 5’ AcrB F CGA TGG ATC CAG TCT TAA CTT AAA CAG GAG C this research
 3’ AcrB R AAT TGC ATG CAT AAA AAA GGC CGC TTA CGC this research
 3’ AcrA R ATA TGC ATG CAC GGC TCC TGT TTA AGT TAA this research
 5’ AcrA F GCACGGATCC TTACATATGAACAAAAACAGAGG this research
 2131 w/in A CCA CTT CTT TGG TAT TGA TGG CAG this research
 2131 w/in B GGA GCT TGG ATA ATG GTG ATG AAA TAA this research
Primers for RT-PCR
petB-F CCTTCGCCTCTGTCCAATAC 55
petB-R TAGCATTACACCCACAACCC 55
 acrA-F CTCTCAGGCAGCTTAGCCCTAA 54
 acrA-R TGCAGAGGTTCAGTTTTGACTGTT 54
 acrB-F GGTCGATTCCGTTCTCCGTTA 54
 acrB-R CTACCTGGAAGTAAACGTCATTGGT 54