Skip to main content

Table 2 Primers used for genotyping

From: Homologous recombination-mediated targeted integration in monkey embryos using TALE nucleases

Primer Sequence (5′ to 3′) Usage Amplicon(bp)
L1-F AGGATCGCTTGAGGACAGGAATT PCR 3259 bp (5’gDNA~ 3’gDNA)
L1-R GGAGCCATCACAGGAGACAGAAAA PCR/sequencing
S1-F GATGCATTGAGGGATAGCTCCACACACACATTC PCR/sequencing 1795 bp (5’ gDNA ~EmGFP)
S1-R AGGACCATGTGATCGCGCTTCT PCR
S2-F CAGAAGAACGGCATCAAG PCR 2109 bp (EmGFP~ 3’gDNA)
S2-R AGTAGGGAGGAAGCAGTAGAA PCR
G-F CACAAGTTCAGCGTGTCCG PCR 421 bp (EmGFP)
G-R AGTTCACCTTGATGCCGTTC PCR  
LI-W1R-G08 ATCCCTCAGCAGCTCTACATTT sequencing  
L1-W2R-H11 CAGCTTCACGGCACCAGTAC sequencing  
L1-W3R-C04 GTAGCGGGCGAAGCACTG sequencing  
S12-W1R-C01 TCCGAGGATCAACCCAGC sequencing  
OT-F CACCACCATTAGGCAAAC PCR 1201 bp target site included
OT-R GAGGCTGAAGTCAATCAAAA PCR