Skip to main content

Table 1 Primer list for overlapping PCR to construct PRRSV-N-Rluc and nsp1α- Rluc plasmids

From: Development of luciferase-linked antibody capture assay based on luciferase immunoprecipitation systems for antibody detection of porcine reproductive and respiratory syndrome virus

  Forward primer Reverse primer
SD16 N CGGAATTCATGCCAAATAACAACGGC CGGTCCGCTACCGGAGCCGCTTGCTG
AGGGTGATGCTGT
HuN4 nsp1α CAGAATTCATGTCTGGGATACTTG CGGTCCGCTACCGGAGCCGCTCATAGC
ACACTCAAAAGG
Renilla luciferase TCCGGTAGCGGACCGGTCGCCACCCTTCCAAGGTGTAC CCGCGGCCGCTTACTGCTCGTTCTTCAG