Skip to main content

Table 2 Primer sequences

From: Myogenic differentiation of primary myoblasts and mesenchymal stromal cells under serum-free conditions on PCL-collagen I-nanoscaffolds

  Forward primer Reverse primer
MYOG TGAGAGAGAAGGGAGGGAAC ACAATACACAAAGCACTGGAA
MyHC2 TGACTTCTGGCAAAATGCAG CCAAAGCGAGAGGAGTTGTC
ACTN2 TCACTGAGGCCCCTTTGAAC AGACAGCACCGCCTGAATAG
RPL13a CTCATGAGGTCGGGTGGAAG AGAGCTGCTTCTTCTTCCGG