Skip to main content

Table 3 Primers used for amplification of the ACER and LysM genes

From: Proof of concept in utilizing in-trans surface display system of Lactobacillus plantarum as mucosal tuberculosis vaccine via oral administration in mice

Genes Sequence 5′ ➔ 3’a Optimal Tm (°C)
ACER Fwd: GGATCCGCTGACCAGCGAGCTGCCGCAA 54
Rev: CTGCAGTGGCTTCCCTTCCGAAACCGC
ACE Fwd:GGATCCGCTGACCAGCGAGCTGCCGCAA 56
Rev:CTGCAGGATATCAGATCTCGCGTTGTTCAGCTCGGTAGC
R0R2 Fwd:GGATCCGAACCTGCGTGAGCGTGCGGAG 54
Rev: CTGCAGTGGCTTCCCTTCCGAAACCGC
LysM Fwd: CTGCAGGGTACCACTACTTATACCGTCAAATC 54
Rev: GCGGCCGCTTATTTTATTCGTAGATACTG
  1. aRestriction enzyme (RE) sites are shown as bold and underlined as either BamHI (GGATCCG), PstI (CTGCAG) or NotI (GCGGCCGC)