Skip to main content

Table 1 Primer sequences used in this study

From: pXST, a novel vector for TA cloning and blunt-end cloning

Name Primer Sequences Product size (bp)
ccdB-F CCAATACTTGTATGGgcagactggctgtgtataaggg 487
ccdB-R CCAATACTTGTATGGctccggtctggtaagcacaac  
ccdBseq-F TCTTTTGCTGACGAGAACAG 210 + (insert)
ccdBseq-R CTTTCATCCCCGATATGCAC  
M13F GTAAAACGACGGCCAGT 126 + (insert)
M13R CAGGAAACAGCTATGACC  
F1 GGCACAGACAAGATTGAACC 517
R1 AACACTGCAATTCCACGATG  
F2 TCCCGGTTGATTCTTTACGTCT 957
R2 CGCAGTTTCCCATTTGTAATCGTC  
F3 TCCCGGTTGATTCTTTACGTCT 1515
R3 CAATCTTGTCTGTGCCCCGAA  
F4 CTTTGCTTCCTATACCACGAGA 2343
R4 ACTAACACTGCAATTCCACGAT  
  1. The underlined sequence is the specific restriction site for XcmI and the small letters is the complementary sequence for the ccdB amplification