Skip to main content

Table 1 Oligonucleotide primers used for the real-time PCR assays, the DNA walking methods and the PCR confirmation of the Cry sequence from the T304–40 event

From: Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes

Methods Oligonucleotide names Oligonucleotide sequences Product sizes (bp) References
SYBR®Green qPCR Cry1Ab/c-F ACCGGTTACACTCCCATCGA 73 [13]
Cry1Ab/c-R CAGCACCTGGCACGAACTC [13]
DNA Walking Cry-F a TGCATTCCATACAACTGCTTGAG   This study
Cry-F b (Cry1Ab/c-F) ACCGGTTACACTCCCATCGA / [13]
Cry-F c GAGTTCGTGCCAGGTGCTG   [13]
DNA Walking Cry-R a (Cry1Ab/c-R) CAGCACCTGGCACGAACTC   [13]
Cry-R b TCGATGGGAGTGTAACCGGT / [13]
Cry-R c CTCAAGCAGTTGTATGGAATGCA   This study
PCR T304–40-Cry-F ACATGGATTATGGCCCACAT 787 This study
T304–40-Cry-R GTTGGCAGCTTGCACATAGA This study