Skip to main content

Table 2 Primers used in this study

From: DNA assembly with error correction on a droplet digital microfluidics platform

Primer Name Primer Sequence (5′- > 3′)
Puc-049cloning-R CCGGGTACCGAGCTCGAATTCACTG
Puc-049cloning-F GATCCTCTAGAGTCGACCTGCAGGC
Puc19-5’F TCCCAGTCACGACGTTGTAAAACGAC
HA049-1 CAGGTCGACTCTAGAGGATCGCGGCCGCGACACATGCACTATTGAAGGACTT
HA049-2 AGATCACAAGAAGGGTTACCATAGACAAGTCCTTCAATAGTGCATGTGTCGC
HA049-3 GTCTATGGTAACCCTTCTTGTGATCTGTTGTTGGGGGGAAGAGAATGGTCCT
HA049-4 TACAGCTGATGGTCTTTCAACGATGTAGGACCATTCTCTTCCCCCCAACAAC
HA049-5 ACATCGTTGAAAGACCATCAGCTGTAAATGGAACGTGTTACCCTGGGAATGT
HA049-6 GTGTTCTGAGTTCCTCTAAGTTTTCCACATTCCCAGGGTAACACGTTCCATT
HA049-7 GGAAAACTTAGAGGAACTCAGAACACTCTTTAGTTCCTCTAGTTCCTACCAA
HA049-8 ATTGTGTCTGGGAATATTTGGATTCTTTGGTAGGAACTAGAGGAACTAAAGA
HA049-9 AGAATCCAAATATTCCCAGACACAATCTGGAATGTGACTTACACTGGAACAA
HA049-10 GTAGAATGAATCTGAACATGATTTGCTTGTTCCAGTGTAAGTCACATTCCAG
HA049-11 GCAAATCATGTTCAGATTCATTCTACAGGAACATGAGATGGCTGACTCAAAG
HA049-12 GAATTCGAGCTCGGTACCCGGCGGCCGCTTTGAGTCAGCCATCTCATGTTCCT