Skip to main content

Table 1 Primers used in this study

From: Heavy ion mutagenesis combined with triclosan screening provides a new strategy for improving the arachidonic acid yield in Mortierella alpina

Primers Sequence(5′-3′) Description
FAS-RTF TCCTTTCTATGGTGCTTCCTCA  
FAS-RTR ATCTTACCTTGCTGCCGTTCT FAS RT-qPCR
Δ5-RTF TGTCTGGAAGATTCTGGGAGC  
Δ5-RTR TTTGGTTGGGCTTGATACGAC Δ5 RT-qPCR
Δ6-RTF TGTTCTGGCAGCAGTGCGGATGG  
Δ6-RTR GGCGTGGTGAGTGTTGTGCTTGTCC Δ6 RT-qPCR
Δ9-RTF TCGTTCAGTGGCAGCACAAGA  
Δ9-RTR CAAGACGGAGGATAGCAGCATA Δ9 RT-qPCR
Δ12-RTF TGGGTGCTGGCTCACGAGTGT  
Δ12-RTR CCAGTGGCCTTGTGGTGCTTC Δ12 RT-qPCR
18S-RTF CGTACTACCGATTGAATGGCTTAG  
18S-RTR CCTACGGAAACCTTGTTACGACT Internal control for RT-qPCR