Skip to main content

Table 1 Oligonucleotides used for inserting of shRNA genes

From: Development of a baculovirus vector carrying a small hairpin RNA for suppression of sf-caspase-1 expression and improvement of recombinant protein production

Name Sequence
Si1F 5’-GGCTAGGATGCCAGTTGATAGATTAATAAGCTCTATCAACTGGCATCCTAGCAAAAAT-3’
Si1R 5’-CTAGATTTTTGCTAGGATGCCAGTTGATAGAGCTTATTAATCTATCAACTGGCATCCTAGCCTGCA-3’
Si2F 5′- GGCTGTATGCCAAAGATACTCATTAATAAGCTGAGTATCTTTGGCATACAGCAAAAAT-3’
Si2R 5′- CTAGATTTTTGCTGTATGCCAAAGATACTCAGCTTATTAATGAGTATCTTTGGCATACAGCCTGCA-3’
Si3F 5′- GGCTAGACTTTGAGTCTAATGCTTAATAAGCGCATTAGACTCAAAGTCTAGCAAAAAT-3’
Si3R 5’-CTAGATTTTTGCTAGACTTTGAGTCTAATGCGCTTATTAAGCATTAGACTCAAAGTCTAGCCTGCA-3’