Skip to main content

Table 4 Oligonucleotides used in this study

From: An att site-based recombination reporter system for genome engineering and synthetic DNA assembly

Oligonucleotide Sequence 5′ – 3′
PhiC31 Int F ATGTACTAATCTAGAGAAGAGGATCAGAAATGGACACGTACGCGGGTGC
PhiC31 Int R CAAGCTTGCATGCCTGCAGG
JB13 AGCGGGTGTTCCTTCTTCACTG
JB485 TCTTCTCTAGATTAGTACATGCAACCA
JB486 CGACTAGAGTCGACCTGCAGCCAAGCTTAGTAAAGCCCTC
MV26 ACGGCTGACATGGGAATTGC
MV143 CCTCTTACGTGCCGATCAACGTCTC
MV145 GCTGGTGATTCCGCTTTGCGACTCAACCTTTTTCACCTAAAGTGCACCGACCGTGA
MV146 ACATCAGCGATCACCTGGCAGAC
attBHKwtERI AATTCCGCTTTGCGACTCAACCTTTTTCACCTAAAGTGCACCGACCGTGAATG
attBHKwtREV GATCCATTCACGGTCGGTGCACTTTAGGTGAAAAAGGTTGAGTCGCAAAGCGG
attBHKmutERI AATTCCGCTTTGCGACACAACCTTTTTCACCTAAAGTGCACCGACCGTGAATG
attBHKmutREV GATCCATTCACGGTCGGTGCACTTTAGGTGAAAAAGGTTGTGTCGCAAAGCGG
40wtERI AATTCTGCGACTCAACCTTTTTCACCTAAAGTGCACCG
40wtREV GATCCCGGTGCACTTTAGGTGAAAAAGGTTGAGTCGCAG
40attBHKmutERI AATTCTGCGACACAACCTTTTTCACCTAAAGTGCACCG
40attBHKmutREV GATCCCGGTGCACTTTAGGTGAAAAAGGTTGTGTCGCAG
30wtERI AATTCTCAACCTTTTTCACCTAAAGTG
30wtREV GATCCACTTTAGGTGAAAAAGGTTGAG
30attBHKmutERI AATTCACAACCTTTTTCACCTAAAGTG
30attBHKmutREV GATCCACTTTAGGTGAAAAAGGTTGTG
30attBHKamp2ORF1min TTTGCTCACAACCTTTTTCACCTAAAGTGGCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTT
30attBHKamp1ORF1min CTTTCACCAGCGTTTCTGGGTGCCACTTTAGGTGAAAAAGGTTGTGAGCAAAAACAGGAAGGCAAAATGCCGC
30attBHKamp2ORF2min TTTGCTACACAACCTTTTTCACCTAAAGTGCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTT
30attBHKamp1ORF2min CTTTCACCAGCGTTTCTGGGTGCACTTTAGGTGAAAAAGGTTGTGTAGCAAAAACAGGAAGGCAAAATGCCGC
30attBHKamp2ORF3min TTTGCTGCCACTTTAGGTGAAAAAGGTTGTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTT
30attBHKamp1ORF3min CTTTCACCAGCGTTTCTGGGTGACAACCTTTTTCACCTAAAGTGGCAGCAAAAACAGGAAGGCAAAATGCCGC
phiC31 ORF1 F TTTGCTTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCCACCCAGAAACGCTGGTGAAAG
phiC31 ORF2 F TTTGCTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCCCACCCAGAAACGCTGGTGAAAG
phiC31 ORF3 F TTTGCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCCCCACCCAGAAACGCTGGTGAAAG
phiC31 ORF4 F TTTGCTGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCACACCCAGAAACGCTGGTGAAAG
phiC31 ORF5 F TTTGCTGGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCCACCCAGAAACGCTGGTGAAAG
phiC31 ORF6 F TTTGCTGGGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCACCCAGAAACGCTGGTGAAAG
phiC31 ORF1 R CTTTCACCAGCGTTTCTGGGTGGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCAAGCAAAAACAGGAAGGCAAAATG
phiC31 ORF2 R CTTTCACCAGCGTTTCTGGGTGGGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCAGCAAAAACAGGAAGGCAAAATG
phiC31 ORF3 R CTTTCACCAGCGTTTCTGGGTGGGGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGAGCAAAAACAGGAAGGCAAAATG
phiC31 ORF4 R CTTTCACCAGCGTTTCTGGGTGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCAGCAAAAACAGGAAGGCAAAATG
phiC31 ORF5 R CTTTCACCAGCGTTTCTGGGTGGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCCAGCAAAAACAGGAAGGCAAAATG
phiC31 ORF6 R CTTTCACCAGCGTTTCTGGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCCCAGCAAAAACAGGAAGGCAAAATG