Skip to main content

Table 1 Primers and oligomers used for PCR of individual genes and the assembly PCR of fusion products

From: Development of plant-produced protein body vaccine candidates for bluetongue virus

Gene/Oligomer Size (bp) Primer Restriction sites (5′ / 3′) 5′ – 3′ sequencea Tm (°C)
Zera® 352 Zera®-FPb,c Zera®-RP AgeI NcoI GCACCGGTATGAGGGTGTTGCTCGTT 62.7 58.3
GCCCATGGCTGGCACGGGCTTGGAT
VP2ep 70 VP2ep-F VP2ep-R MluI XmaI GCACGCGTTTCCCAGAGCACCTTCGACACGATGTAACAAAT 76.7 79.8
GCCCCGGGTCCACGCAGGCAGGGATACGGATTTGTTACATC
Linker    NcoI/MluI CCATGGGAAGCGGCGGCGAAAACGCGT 75.9
   Linker-VP2ep-FPb   GAAGCGGCGGCGAAAACGCGTTTCCCAGAGCACCTT 77.3
   Linker-Zera®-RPb   TTTCGCCGCCGCTTCCCATGGTCTGGCACGGGCTTG 81.4
   VP2ep-RPb,c XmaI GCCCCGGGTCCACGCAGGCAGGG 56.8
VP2 ~2800 cTPVP2coF MluI GTGGACGCGTTAGGTGCATGGAAGAACTCGCTATCCCAA 56
   cVP2coR XhoI GCCTCGAGTCAAACGTTGAGGAGCTTAGTAAG 54
Sequencing primers   pEAQ-FP pEAQ-RP   GACGAACTTGGAGAAAGATTGTTAAGC 61.2 62.3
AACCAGAGTTAAAGGCCTCGAGC
  1. aThe restriction enzyme sites are underlined and in bold
  2. b,cPrimers used for first and second stage assembly PCR of Zera®-VP2ep