Skip to main content

Advertisement

Table 1 Primers utilized in this study

From: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression

Primer name Sequence
GLuc-F TTGGCGCGCCGCCACCATGGGAGTCAAA
GLuc-R GAGGCTGATTTTGCGTCTAGA
T7 TAATACGACTCACTATAGGG
Seq-R TTACGCCAAGTTATTTAGGTGACA
H3-F AAGGAGCTCGAGCCACCATGGCTCGT
H3-R GGTTACCTTAAGCACGTTCTCCA
SGLuc8990–MF CCAAGATGAAGAAGTGGCTCCCAGGACGCTGCC
SGLuc8990–MR GGCAGCGTCCTGGGAGCCACTTCTTCATCTTGG
GLuc-NS-NheI-R CGGCGCTAGCGTCACCACCGGCCCCCTT
AscI-Kzk-GLuc-F TTGGCGCGCCGCCACCATGGGAGTCAAA
2A-XmaI-R TATACCCGGGTCCAGGGTTGGACTC
GLuc-R-NotI GCGGCCGCTTAGTCACCACCGGCCCC
GLuc8990–MF CCAAGATGAAGAAGTTCATCCCAGGACGCTGCC
GLuc8990–MR GGCAGCGTCCTGGGATGAACTTCTTCATCTTGG
No Met GLuc-MF TCCAACCCTGGGCCCGGAGTCAAAGTTCTG
No Met GLuc-MR CAGAACTTTGACTCCGGGCCCAGGGTTGGA
NotI-3CLeb89-F CAGCGGCCGCATGAGTGGTGCCCCACCG
3CLeb89-EcoRI-R GAATTCCTACTCGTGGTGTGGTT
3CLeb89-ns-EcoRI-R GAATTCCTCGTGGTGTGGTTC