Skip to main content

Table 1 All primers used in this study

From: Characterization of calcineurin from Cryptococcus humicola and the application of calcineurin in aluminum tolerance

Primer pairs Description Forward primer Reverse primer
CNA-qRT-F and CNA-qRT-R Partial fragment of CNA gene was 190 bp AACGGTGCGGAGGGTAT GCTGTGCCAGTCTTGTCG
18S-F and 18S-R Partial fragment of 18S rDNA gene was 198 bp ATGCTGAAAAGCCCCGACT ATTCCCCGTTACCCGTTG
CaM-F and CaM-R the fragment of CaM gene was 450 bp 5′-GAATTCATGGCGGAGCAGCTGACCAAG-3′(EcoRI site underlined) 5′-CTCGAGTTACTTGGCCATCATCATG GTAAC-3′ (XhoI site underlined)
CNA-F and CNA-R the fragment of CNA gene was 1917 bp 5′-GAATTCATGACCTC TCCGGCGAC-3′
(EcoRI site underlined)
5′-GCGGCCGCTTAGGCAATAGAGTTC TC-3′ (Not I site underlined)
CNAa-F and CNAa-R 1-1284 bp fragment of CNA, excluding calmodulin binding domain 5′-GAATTCATGACCTCTCCGGCGAC-3′
(EcoRI site underlined)
5′-GCGGCCGCCCTC TCCGCCGAGATGTC -3′ (Not I site underlined)
CNAb-F and CNAb-R 1-1362 bp fragment of CNA, including calmodulin binding domain 5′-GAATTCATGACCTCTCCGGCGAC-3′ (EcoRI site underlined) 5′-GCGGCCGCCGAGAACACTCGCGACAT-3′ (Not I site underlined)
mut-∆CNA1-F and mut-∆CNA1-R Replace Ile439 with Ala439 GGAGAGGAGACAGGTTGCCAAGAACAAGATTCTC GAGAATCTTGTTCTTGGCAACCTGTCTCCTCTCC
mut-∆CNA2-F and mut-∆CNA2-R Replace Ile443 with Ala443 GGTTATCAAGAACAAGGCTCTCGCTGTTGGTCGC GCGACCAACAGCGAGAGCCTTGTTCTTGATAACC
mut-∆CNA3-F and mut-∆CNA3-R Replace Val446 with Ala446 AACAAGATTCTCGCTGCTGGTCGCATGTCGCGA TCGCGACATGCGACCAGCAGCGAGA ATCTTGTT
mut-∆CNA4-F and mut-∆CNA4-R Replace Val452 with Ala452 GGTCGCATGTCGCGAGCGTTCTCGTTGCTTCGT ACGAAGCAACGAGAACGCTCGCGACATGCGACC
mut-∆CNA5-F and mut-∆CNA5-R Replace Phe453 with Ala453 CGCATGTCGCGAGTGGCCTCGTTGC TTCGTGAG CTCACGAAGCAACGAGGCCACTCGC GACATGCG