Skip to main content

Advertisement

Table 3 Oligonucleotides used in this study

From: Penicillin production in industrial strain Penicillium chrysogenum P2niaD18 is not dependent on the copy number of biosynthesis genes

Name Sequence (5’➔3’) Specificity
3’pcbC_s TTCGTCGAGAACGGTGAAGC downstream region of pcbC 3’flank used for homologous recombination
Phleo_s TCCTGCGCCTGATACAGAAC 3’region phleomycin resistance cassette
PtrpC_a TGTTGACCTCCACTAGCTCC 5’region PtrpC
5’pcbC_a TAGTGGCCGAGAAGCCTATC upstream region of pcbC 5’ flank used for homologous recombination
pcbC_s TATACCATGGATGGCTTCCACCCCCAAGG pcbC
pcbC_a TACTCCATGGTAGTCTGGCCGTTCTTGTTG pcbC
SSU1 ATCCAAGGAAGGCAGCAGGC SSUr RNA
SSU2 TGGAGCTGGAATTACCGCG SSUr RNA
PcpcbC-RT_s CCCTCCCGTTCTTCGTCAATC pcbC (qRT-PCR)
PcpcbC-RT_a CTGCAGATAGTAGCCGTACGA pcbC (qRT-PCR)