Skip to main content

Table 3 Oligonucleotides used in this study

From: Penicillin production in industrial strain Penicillium chrysogenum P2niaD18 is not dependent on the copy number of biosynthesis genes

Name Sequence (5’➔3’) Specificity
3’pcbC_s TTCGTCGAGAACGGTGAAGC downstream region of pcbC 3’flank used for homologous recombination
Phleo_s TCCTGCGCCTGATACAGAAC 3’region phleomycin resistance cassette
5’pcbC_a TAGTGGCCGAGAAGCCTATC upstream region of pcbC 5’ flank used for homologous recombination