Skip to main content

Table 1 Primer sequences of sepecific genes

From: Repair of cartilage defects in osteoarthritis rats with induced pluripotent stem cell derived chondrocytes

Primer name Sequence(5' to 3')
Sox 9 F GGAGATGAAATCTGTTCTGGGAATG
R TGAAGGTTATCTGCTGGTGTTCTGA
ACAN F TCTACCGCTGCGAGGTGA
R TGTAATGGAACACGATGCCTTT
Col2a1 F GGAAGAGTGGAGACTACTGGATTGAC
R TCCATGTTGCAGAAAACCTTCA
Nanog F ACAACTGGCCGAAGAATAGCA
R GGTTCCCAGTCGGGTTCAC
Oct 4 F GGAGGAAGCTGACAACAATGAAA
R GGCCTGCACGAGGGTTT
β-actin F CGAGAAGATGACCCAGATCATG
R ACAGCCTGGATAGCAACGTACA