Skip to main content

Table 1 Primers and synthesized oligonucleotides

From: Intracellular delivery of messenger RNA by recombinant PP7 virus-like particles carrying low molecular weight protamine

Primer Sequence(5’-3’)
PP7-for 5’-GGAATTCCATATGTCCAAAACCATCGTTC-3’
GFP-for 5’-GCTCTAGAGCCGCCATGGTGAGCAAGGGCGAGGA-3’
GFP-r 5’-CGGGATCC TAAGGGTTTCCATATAAACTCCTTATCATTACTTGTACAGCTCGTCCA-3’
PP7-r 5’-CCGCTCGAGTTAACGGCCCAGCGGCAC-3’
2PP7-Protamine-for 5’-GGGGTACC GTTAGCCGTCGCCGTCGCCGTCGCGGCGGTCGTCGCCGTCGCGAGGCAACCCGCACTCTG-3’
GFP-qRT-for 5’-GCAGAAGAACGGCATCAA-3’
GFP-qRT-r 5’-GGTGCTCAGGTAGTGGTTGT-3’
GAPDH-for 5’-AAATGGTGAAGGTCGGTG-3’
GAPDH-r 5’-GTGAGTGGAGTCATACTGGAAC-3’
  1. Restriction enzyme sites Nde I, Kpn I and Xho I are underlined; the cDNA sequence of LMWP is in boldface; pac site is in italic type