Skip to main content

Table 1 Primers used for qPCR studies

From: A simple, accurate and universal method for quantification of PCR

Gene Accession number Primer sequence Annealing temperature Amplicon size
Lambda NC_001416 For: CGGCGTCAAAAAGAACTTCC 60 °C 92 bp
Lambda NC_001416 For: CGGCGTCAAAAAGAACTTCC 60 °C 501 bp
Ar NM_013476.3 For: ACCCAAAACCCACCTTGTT 64 °C 214 bp
Actb NM_007393.3 For: AGCCATGTACGTAGCCATCC 64 °C 377 bp
Rpl19 NM_009078.2 For: GATCATCCGCAAGCCTGTGACT 60 °C 362 bp
Hmbs NM_001110251.1 For: TGATGAAAGATGGGCAACTG 64 °C 160 bp
Rps9 NM_029767.2 For: ATTACATCCTGGGGCCTGAAG 64 °C 210 bp
Ppia BC083076.1 For: ATCACGGCCGATGACGAGCC 64 °C 217 bp
Hprt NM_013556.2 For: GATACAGGCCAGACTTTGTTGG 64 °C 154 bp
CD40 NG_007279 For: GAAACTGGTGAGTGACTGC 60 °C 341 bp