Skip to main content

Table 1 Sequence of single guide RNA (gRNA), forward and reverse PCR primers (PCR-fw and PCR-rev), and primers used for sequencing (p1 and p2)

From: Death receptor-based enrichment of Cas9-expressing cells

Gene Type/Name Sequence Genomic location (Assembly Dec. 2013 GRCh38/hg38)
IRF3
encoded on (−) strand of genome
gRNA-1 GCCACTGGTGCATATGTTCC 19:49663483–49663502 (−)
gRNA-2 CCACTGGTGCATATGTTCCC 19:49663482–49663501 (−)
gRNA-3 ATAAGCCAGACCTGCCAACC 19:49663455–49663474 (−)
PCR-fw TTCTCACCTGGGTATCAGAAGTA 19:49663181–49663203 (+)
PCR-rev TGAGGTTCCTAACTACCGAATTA 19:49664294–49664316 (−)
p1 TGTCTGGCTGGGAAAAGTC 19:49663232–49663250 (+)
p2 CTGTAATCCCAGCACTTTG 19:49663960–49663978 (−)
TLR3
encoded on (+) strand of genome
gRNA-1 ACATTAGATCTGTCTCATAA 4:186078849–186078868 (+)
gRNA-2 ATTAGGAACTCAGGTTCAGC 4:186078887–186078906 (+)
gRNA-3 GGCTTGTCATCTACAAAATT 4:186078870–186078889 (+)
PCR-fw TGTGTTTGATAAGCCATGTGA 4:186078463–186078483 (+)
PCR-rev GGAGGCTAGAGAGGGAGAAC 4:186079465–186079484 (−)
p1 AATCCTTCCTACAATGG 4:186078618–186078634 (+)
p2 AGGATTGCTGGAAGACAGG 4:186079129–186079147 (−)
p65
encoded on (−) strand of genome
gRNA-1 TCAATGGCTACACAGGACCA 11:65661815–65661834 (−)
gRNA-2 AGGGACAGTGCGCATCTCCC 11:65661796–65661815 (−)
gRNA-3 AGCTTGTAGGAAAGGACTGC 11:65661737–65661756 (−)
PCR-fw AATGGTTTTCTTCCTCAAACAA 11:65661392–65661413 (+)
PCR-rev CTTAGTTTCACCGCAGGTTCTA 11:65662331–65662352 (−)
p1 GTATCCCCTGGAACTCATC 11:65661487–65661505 (+)
p2 TGTTCCCCCTCATCTTC 11:65662186–65662202 (−)
gfp gRNA AAGGGCGAGGAGCTGTTCAC -