Skip to main content

Table 2 E. coli strains, plasmids and primers used in this study

From: Enhancement of D-lactic acid production from a mixed glucose and xylose substrate by the Escherichia coli strain JH15 devoid of the glucose effect

Strains Relevant characteristics Sources
B Wild type ATCC
 WL204 E. coli B, ΔfrdBC ΔldhA ΔackA ΔpflB ΔpdhR ::pflBp6-acEF-lpd ΔmgsA ΔadhE, ΔldhA::ldhL, metabolically evolved in xylose with improved anaerobic growth [30]
 JH12 WL204, ΔldhL::FRT-kan-FRT (chromosomal insertion of kan marker to replace ldhL gene), lost anaerobic cell growth, kanamycin positive This study
 JH13 JH12, ΔFRT-kan-FRT::ldhA (chromosomal insertion of ldhA to replace kan marker), regaining anaerobic cell growth, kanamycin sensitive This study
 JH14 JH13, ΔptsG::FRT-kan-FRT, slow glucose utilization due to disruption of the major glucose transporter system (PTS system) This study
 JH15 JH14, metabolically evolved in glucose with improved glucose uptake (probably through alternative glucose transporter) This study
Plasmids
 pKD4 FRT-kan-FRT cassette [5]
 pKD46 bla, red recombinase, temperature-dependent replication [5]
 pFT-A bla, flp, temperature-dependent replication [22]
Primers
 Deletion ldhL-P1 TGTTTCGCTTCACCGGTCAGCTGTGTGTAGGCTGGAGATGCTTC a This study
 Deletion ldhL-P2 TCGCTAATGGTGTTATCGAGTTAGCCATATGAATATCCTCCTTAG a This study
 Cloning ldhA-P1 TGCAGCACGA AATCGCCCAG TTCAT This study
 Cloning ldhA-P2 TGTGTGCATTACCCAACGGCAAACG This study
 Deletion ptsG-P1 ATGTTTAAGAATGCATTTGCTAACCGTGTGTAGGCTGGAGATGCTTC a This study
 Deletion ptsG-P2 TTAGTGGTTACGGATGTACTCATCCAAGCCATATGAATATCCTCCTTAG a This study
  1. aThe underlined sequence is homologous to the flanked sequence of FRT-kan-FRT cassette in pKD4