Skip to main content

Table 3 Primer sequences of the three single point mutations on AAV-DJ capsid

From: Single point mutation in adeno-associated viral vectors -DJ capsid leads to improvement for gene delivery in vivo

Residue Sequence (5’ to 3’) Nucleotide change
K137R Wild-type primer sequence: TGAGGAAGCGGCTAAGACG AAG → AGG
Mutant primer sequence: TGAGGAAGCGGCTAGGACG
T251A Wild-type primer sequence: CCCTGCCCACCTACAACAAC ACC → GCC
Mutant primer sequence: CCCTGCCCGCCTACAACAAC
S503A Wild-type primer sequence: GTGAATACTCGTGGACTGGAG TCG → GCG
Mutant primer sequence: GTGAATACGCGTGGACTGGAG