Skip to main content

Advertisement

Table 1 The genes, primer sequences and the size of the amplification product

From: Dental follicle stem cells in bone regeneration on titanium implants

Genes Primer sequences (5′ → 3′) forward and reverse Size of the product [bp]
Oct-3/4 aggagtcccaggacatcaaag; tcgtttggctgaataccttc 146
Rex-1 atggctatgtgtgctatgagc; ctcaacttcctagtgcatcc 447
TERT catcatcaaaccccagaacac; caaacagcttgttctccatgt 371
Nanog attataaatctagagactccag; tcctgaataagcagatccatg 407
Sox-2 aagcgctttttttgatcctgattc; accacaccatgaaggcattcatg 363
SCF tatttaatcctctcgtcaaaac; agaattcttcaggagtaaagag 369
HLA-DRα ttgaagaatttggacgatttg; aaactcccagtgcttgagaagag 407
Vimentin ttcagagagaggaagccgaaaac; tttaagggcatccacttcacag 422
c-kit (CD117) ttcagcgagagttaatgattctg; tgtattcacataaacattaaatg 400
Thy-1 (CD90) aaagaagcacgtgctctttggc; actcagagaagtaggatctctg 379
CBFβ aacgaggagttttttaggaagc; attcagaatcatgggagccttc 273
Tie-2 tctgtactgcttgtatgaacaatg; tttaccactgtttacttctatatg 405
HLA-ABC acccaggacacggagctcgtggagacca; cacactttacaagctgtgagagacaca 354
CXCR4 attcctttgcctcttttgcagatata; atggccaggtagcggtccagactgatgaa 418