Skip to main content

Advertisement

Table 1 List of the primers and probes of the reference genes used in the RT-qPCR analysis

From: Transcriptome study and identification of potential marker genes related to the stable expression of recombinant proteins in CHO clones

Gene Name Forward Primer (5′ → 3′) Reverse Primer (5′ → 3′) Probe (5′ → 3′)
Reference gene for copy number
Glucagon (Gluc) ATTGCCAAACGCCACGAT CCAAGCAATGAATTCCTTTGC CTGAAGGGACCTTTACCA
Reference genes for gene expression
Actb AGCCACGCTCGGTCAG CATCCTGCGTCTGGACCT CCGGGACCTGACAGACT
Gapdh TCAACGGGAAGGCCATCAC CCATTTGATGTTGGCGGGATC TCGCTCCTGGAAGATG
Transgene
rDhfr ATATGGGGATTGGCAAGAACG CATTCTTTGGAAGTACTTGAACTCGTT AGACCGACCCTGGC
  1. The reference genes were used for the copy number and gene expression calculations. All of the primers and probes were designed as TaqMan Gene Expression Assays labelled with FAM (3′) and MGB (5′). The sequence of the recombinant gene is confidential