Skip to main content

Table 1 Primers used for gene cloning and expression

From: A novel eurythermic and thermostale lipase LipM from Pseudomonas moraviensis M9 and its application in the partial hydrolysis of algal oil

Primers Function Sequence (5'-3')
T5 Degenerate primer ACAATGTGCTGAACATNGGNTAYGARA
T3 Degenerate primer GAAGGCGCCGCTGAANANNWANGTNTT
lipM9-5-1 Upstream genome walking GACGCTTCCGCCAGGTTG
lipM9-5-2 Upstream genome walking AGCCGTGAGCCGACCAGTTC
lipM9-5-3 Upstream genome walking CCTGGTGTCCGTCGTGCTTG
lipM9-3-1 Downstream genome walking GCTGTACGTGCGTGATGCCTAT
lipM9-3-2 Downstream genome walking GGTGGGGGAGCAAGGAGGT
lipM9-3-3 Downstream genome walking ACGGCAACACACTGGCAGC
lipM9-F Complete genetic sequence ATGGGAYTGTTCGATTACARAAAYGCCGA
lipM9-R Complete genetic sequence TYASGCRAASRYGAWRCYYGAAKCCGACAGG
lipM9-NF Expression vector construction CTCATATGGGATTGTTCGATTAC
lipM9-XR Expression vector construction CTCTCGAGCGCAAACATGATACTT
  1. a): Note: N represents A, C, G, or T; Y identifies C or T; R represents A or G; W identifies A or T. b): Nde I, Xho I restriction sites in primers are underlined, respectively