Skip to main content

Table 3 Primers used in this study

From: Overproduction of pro-transglutaminase from Streptomyces hygroscopicus in Yarrowia lipolytica and its biochemical characterization

Primer Sequence (5′-3′)
1296P1 CCCAAGCTTGCCAGCGGCGGCGACG (underlined bases correspond to Hind III site)
1296P2 CGGGGTACCTTACGACCAGCCCTGCTTCACCTC (underlined bases correspond to Kpn I site)
1297P1 TTGGGCCGTTCTGGCCGCCAGCGGCGGCGACG (underlined bases correspond to Sfi I site)
1297P2 CGCGGATCCTTACGACCAGCCCTGCTTCACCTC (underlined bases correspond to BamH I site)
7N160Q1 CCCCAGGAGACGCAAGCCGAGTTT (underlined bases encode Gln)
7N160Q2 GCGTGGCCTGCTGTTTTCCAGGTC
7N355Q1 CGGCAGTGGTCTGCCGGGTA (underlined bases encode Gln)
7N355Q2 GAACTTGCTCTCGTATACGTTCATGGG