Skip to main content

Table 1 Oligonucleotide primers used for the real-time PCR assays, the DNA walking approaches and the PCR confirmation of the transgenic junctions

From: Integrated DNA walking system to characterize a broad spectrum of GMOs in food/feed matrices

Methods Oligonucleotide names Oligonucleotide sequences Product sizes (bp) References
SYBR®Green qPCR p35S F AAAGCAAGTGGATTGATGTGATA 75 [6]
  p35S R GGGTCTTGCGAAGGATAGTG [6]
SYBR®Green qPCR tNOS F GATTAGAGTCCCGCAATTATACATTTAA 69 [6]
  tNOS R TTATCCTAGKTTGCGCGCTATATTT [6]
SYBR®Green qPCR t35S pCAMBIA c-F CGGGGGATCTGGATTTTAGTA 137 [14]
  t35S pCAMBIA a-R AGGGTTCCTATAGGGTTTCGCTC [14]
DNA Walking p35S-F a (p35S R) GGGTCTTGCGAAGGATAGTG   [6]
  p35S-F b TGTGCGTCATCCCTTACGTCAGT / This study
  p35S-F c TATCACATCAATCCACTTGCTTT   [6]
DNA Walking p35S-R a (p35S F) AAAGCAAGTGGATTGATGTGATA   [6]
  p35S-R b ACTGACGTAAGGGATGACGCACA / This study
  p35S-R c CACTATCCTTCGCAAGACCC   [6]
DNA Walking tNOS-F a (tNOS F) GATTAGAGTCCCGCAATTATACATTTAA   [6]
  tNOS-F b TTAATACGCGATAGAAAACAAAAT / This study
  tNOS-F c AAATATAGCGCGCAAMCTAGGATAA   [6]
DNA Walking tNOS-R a (tNOS R) TTATCCTAGKTTGCGCGCTATATTT   [6]
  tNOS-R b ATTTTGTTTTCTATCGCGTATTAA / This study
  tNOS-R c TTAAATGTATAATTGCGGGACTCTAATC   [6]
PCR junction Rice chromosome II CCCCTAATTTCTCACAGGCC 848 This study
  tNOS-F c AAATATAGCGCGCAAMCTAGGATAA [6]
PCR junction Rice chromosome III AGGTACTCAAGCCTTTTCCAGC 1105 This study
  tNOS-F c AAATATAGCGCGCAAMCTAGGATAA [6]