Skip to main content

Table 2 Primer and adapter sequences used in this study

From: Feasibility of Cowpea chlorotic mottle virus-like particles as scaffold for epitope presentations

Construct Primer set 5ˊ → 3ˊ
CCMV-CP GCGCCATGGGTACAGTCGGAACAGGGAAGTTAACTC (F)
GGAAGCTTCACTAATACACCGGAGTG (R)
NΔ24CP GGGCCATGGGGACTCGTGTGGTCCAAC (F)
GGAAGCTTCACTAATACACCGGAGTG (R)
His-LBC CGCACTAGTCATCACCATCACCATCACGAGCTCGCTGCCGAAGCTAAAGTAACCTCG (F)
CGCACTAGTCGCACAAGAGGCGGTCCAC (R)
His-LDE CGCACTAGTCATCACCATCACCATCACGAGCTCCCCAGTGTTAGTGGCACAGTGAAATC (F)
CGCACTAGTAAGCAACCCAAGCCATAATAAAACTCTACC (R)
His-LFG CGCACTAGTCATCACCATCACCATCACGAGCTCTCGAAAGATGTTGTCGCTGCTATGTAC (F)
CGCACTAGTGTTGTCGGCCACAGCTAATGCC (R)
His-LHI CGCACTAGTCATCACCATCACCATCACGAGCTCGCGGCTCTCACTGAGGGCGAC (F)
CGCACTAGTACTGCTGTACAAGTAGATCGTTAAATCCGC (R)
M2e (7) loop adaptor CTAGTCTGCTGACCGAAGTGGAGCT (F)
CCACTTCGGTCAGCAGA (R)
M2e (15) loop adaptor CTAGTCTGCTGACCGAAGTGGAAACCCCGACCCGCAACGGCTGGGAGCT (F)
CCCAGCCGTTGCGGGTCGGGGTTTCCACTTCGGTCAGCAGA (R)
M2e (23) loop adaptor CTAGTAGCCTGCTGACCGAAGTGGAAACCCCGACCCGCAACGGCTGGGAATGCCGCTGCAGCGAT
AGCAGCGATGAGCT (F)
CATCGCTGCTATCGCTGCAGCGGCATTCCCAGCCGTTGCGGGTCGGGGTTTCCACTTCGGTCAGCA
GGCTA (R)
His-CP* GGGCCATGGGTCACCACCACCACCACCACACAGTCGGAACAGGGAAGTTAAC (F)
CCCAAGCTTCACTAATACACCGGAGTGAAAGAGTCGTCAAACGTAGGTCTGAC (R)
CP-His* CGCCCATGGGTACAGTCGGAACAGGGAAGTTAACTCGTGCACAACGAAGGGC (F)
GGGAAGCTTCACTAGTGGTGGTGGTGGTGGTGATACACCGGAGTGAAAGAGTCGTC (R)
His-CP-His* GGGCCATGGGTCACCACCACCACCACCACACAGTCGGAACAGGGAAGTTAAC (F)
GGGAAGCTTCACTAGTGGTGGTGGTGGTGGTGATACACCGGAGTGAAAGAGTCGTC (R)
His- NΔ24CP * GGGCCATGGGTCACCACCACCACCACCACACTCGTGTGGTCCAACC (F)
CCCAAGCTTCACTAATACACCGGAGTGAAAGAGTCGTCAAACGTAGGTCTGAC (R)
HA- NΔ24CP* GGGCCATGGGGTGGACCATTCTGAAACCGAACGATGCGATTAACTTTGAAAGCAACCCCGGGACTCGTGTGGTCCAACCTG (F)
CCCAAGCTTCACTAATACACCGGAGTGAAAGAGTCGTCAAACGTAGGTCTGAC (R)
His-HA- NΔ24CP* GGGCCATGGGGCACCACCACCACCACCACTGGACCATTCTGAAACCGAAC (F)
CCCAAGCTTCACTAATACACCGGAGTGAAAGAGTCGTCAAACGTAGGTCTGAC (R)
M2e(23) NΔ24CP* CAACGGCTGGGAATGCCGCTGCAGCGATAGCAGCGATCCCGGGACTCGTGTGGTCCAACCTG (F1)
GGGCCATGGTCATGGTCAGCCTGCTGACCGAAGTGGAAACCCCGACCCGCAACGGCTGGGAATGCCGCTGC (F2)
CCCAAGCTTCACTAATACACCGGAGTGAAAGAGTCGTCAAACGTAGGTCTGAC (R)
CP-HA* CGCCCATGGGTACAGTCGGAACAGGGAAGTTAACTCGTGCACAACGAAGGGC (F)
CGTTCGGTTTCAGAATGGTCCAATACACCGGAGTGAAAGAGTCG (R1)
CCCAAGCTTCACTAGTTGCTTTCAAAGTTAATCGCATCGTTCGGTTTCAGAATGG (R2)
CP-M2e(23)* CGCCCATGGGTACAGTCGGAACAGGGAAGTTAACTCGTGCACAACGAAGGGC (F)
CCCAGCCGTTGCGGGTCGGGGTTTCCACTTCGGTCAGCAGGCTATACACCGGAGTGAAAGAG (R1)
CCCAAGCTTCACTAATCGCTGCTATCGCTGCAGCGGCATTCCCAGCCGTTGCGGGTCGGG (R2)
VP1-CP/ VP1 NΔ24CP Adaptor CATGGTACGGTGACACCAGCACTAACAACGTGAGAGGTGACCTTCAAGTGTTAGCTCAGAAGGCAGAAAGAACTCTGCCTGGGTCGA (F)
CTAGTCGACCCAGGCAGAGTTCTTTCTGCCCTCTGAGCTAACACTTGAAGGTCACCTCTCACGTTGTTAGTGCTGGTGTCACCGTAC (R)
2C-CP/2C NΔ24CP adaptor CATGGGAATGGCTGGACAACGCGCGTCAAGCGGGGTCGACGCGTGGGA (F)
CTAGTCCCACGCGTCGACCCCGCTTGACGCGCGTTGTCCAGCCATTCC (R)
26GNVΔ24CP* GATACCGGCGAAGTGATTCTGAACAGCTATCGCATTAACCATTATCGCACTCGTGTGGTCCAACC (F1)
CGCCCATGGGGAGAGTTGAATGCGAAATTGCGCTGAACAAAGATACCGGCGAAGTG (F2)
CCCAAGCTTCACTAATACACCGGAGTGAAAGAGTCGTCAAACGTAGGTCTGAC (R)
31GCVΔ24CP* GAAGAATGGGGCTGCCTGGCGATTAACGATGGCTGCCTGTATGGCAGCTGCCAGGATATTACTCGTGTGGTCCAACC (F1)
CGCCCATGGGGTTTAGCAAAGAACGCAGCAGCAACTGGGGCTGCGAAGAATGGGGCTGC (F2)
CCCAAGCTTCACTAATACACCGGAGTGAAAGAGTCGTCAAACGTAGGTCTGAC (R)
Δ24CP15GN* GGGCCATGGGGACTCGTGTGGTCCAAC (F)
CTTTCACGCAGCATTCGCTCACATACACCGGAGTG (R1)
GGGAAGCTTCTAGCTTTTAATAATGCTAATATCATCTTTCACGCAGC (R2)
Δ24CP16GC* GGGCCATGGGGACTCGTGTGGTCCAAC (F)
CATTCTTCGCAGCCCCAGTTGCTGCTATACACCGGAGTG (R1)
GGGAAGCTTCTAATCGTTAATCGCCAGGCAGCCCCATTCTTCGCAG (R2)
  1. Restriction enzymes (BamHI, HindIII, NcoI, PstI, SpeI and SstI) and adaptor overhangs are shown in underlined letters.* Epitopes were PCR-fused to the CPs by two rounds of PCR
\