Skip to main content

Table 1 Nucleotide sequences of oligonucleotides designed for assembly of IFN-CSP*

From: High-level expression of a novel liver-targeting fusion interferon with preferred Escherichia coli codon preference and its anti-hepatitis B virus activity in vivo

Primers Location Nucleotide sequence (from 5′ end to 3′ end)
SR-1 1–29 GGAATTCCATATG TGTGATCTGCCTCAAA
AR-1 14–71 GTGCCAGGAGCATCAAGGTACGACGGCTACCCAGGCTGTGGGTTTGAGGCAGATCACA
SR-2 53–110 ACCTTGATGCTCCTGGCACAGATGCGTCGTATCTCTCTTTTCTCCTGCTTGAAGGACC
AR-2 92–149 GGTTGCCAAACTCCTCCTGTGGAAATCCAAAGTCATGACGGTCCTTCAAGCAGGAGAA
SR-3 131–188 CAGGAGGAGTTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAGA
AR-3 170–227 AGTCCTTTGTGCTGAAGAGATTGAAGATCTGCTGGATCATCTCATGGAGGACAGGGAT
SR-4 209–266 CTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTTGACAAATTCT
AR-4 248–305 AGGCTTCCAGGTCATTCAGCTGCTGGTAGAGTTCAGTGTAGAATTTGTCAAGGAGGGT
SR-5 287–344 CTGAATGACCTGGAAGCCTGTGTGATTCAGGGGGTGGGGGTGACAGAGACTCCACTGA
AR-5 326–383 GGAAGTATTTACGCACAGCCAGAATGGAGTCCTCCTTCATCAGTGGAGTCTCTGTCAC
SR-6 365–422 GCTGTGCGTAAATACTTCCAACGTATCACTCTCTATCTGAAAGAGAAGAAATACAGCC
AR-6 404–461 AACGCATGATTTCTGCACGGACAACCTCCCAGGCACAAGGGCTGTATTTCTTCTCTTT
SR-7 443–500 CGTGCAGAAATCATGCGTTCTTTTTCTTTGTCAACAAACTTGCAAGAAAGTTTACGTA
AR-7 482–525 CGTAATTTCTCGTTGTCTTCCTTACTACGTAAACTTTCTTGCAA
SR-8 507–561 AAGACAACGAGAAATTACGTAAACCAAAACATAAAAAATTAAAGCAACCAGCGGA
AR-8 545–578 CCGCTCGAG ATTAACCATCCGCTGGTTGCTTTAA
  1. *Letters in italic denote the overlapped parts in IFN-CSP. Restriction sites are underlined. Bold type indicates the additional terminal codon ‘TAAT’